Sequence ID | >WENV170012540 |
Genome ID | ASRL01000657 |
Phylum/Class | [ASRL] bioreactor metagenome; day 67 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 36 |
End posion on genome | 132 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
taattgcttt |
tRNA gene sequence |
GGAAGTAGATAGGTAACTGGTGTGCCTACCGGTCTTCAAAACCGAGTTTTGGCGTTTGCT |
Downstream region at tRNA end position |
aatataaatt |
Secondary structure (Cloverleaf model) | >WENV170012540 SeC(p) TCA t GCCA aatataaatt G - C G - C A - T A - T G - C T - A A - T G A T T A C A C C C A C A A T | | | | | G T T G G A G T G G G C G + | | | T T G G C C T T G T A GTTTTGGCGTTTGCTCGTCATGG C A C - G G - C G - C T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |