Sequence ID | >WENV170012555 |
Genome ID | ASRL01001117 |
Phylum/Class | [ASRL] bioreactor metagenome; day 67 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 987 |
End posion on genome | 911 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
tttcatatac |
tRNA gene sequence |
GCACCAGTAGCTCAGCTGGATAGAGTACTGCCCTCCGAAGGCAGGGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
taattcgtta |
Secondary structure (Cloverleaf model) | >WENV170012555 Arg CCG c GCCA taattcgtta G - C C - G A - T C - G C - G A - T G - C T A T C G C C C A C G A A | + | | | G T C T C G G T G G G C G | | | + T T G G A G T A T A A GGGTC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |