Sequence ID | >WENV170012556 |
Genome ID | ASRL01001388 |
Phylum/Class | [ASRL] bioreactor metagenome; day 67 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 35 |
End posion on genome | 111 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ataatttttt |
tRNA gene sequence |
GGGGGTGTAGCTCAGTTGGTTAGAGTGCCTGCCTGTCACGCAGGATGTCGCGAGTTCGAG |
Downstream region at tRNA end position |
tatattaaat |
Secondary structure (Cloverleaf model) | >WENV170012556 Asp GTC t GCCA tatattaaat G - C G - C G - C G + T G - C T - A G - C T G T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | + T T G G A G T T T A G ATGTC C - G C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |