Sequence ID | >WENV170012560 |
Genome ID | ASRL01001662 |
Phylum/Class | [ASRL] bioreactor metagenome; day 67 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 207 |
End posion on genome | 131 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
cggccattgc |
tRNA gene sequence |
AGGCACATAGCTCAGTTGGTTAGAGCACCACCTTGACATGGTGGGGGTCGTTGGTTCGAA |
Downstream region at tRNA end position |
aacataccaa |
Secondary structure (Cloverleaf model) | >WENV170012560 Val GAC c ACCA aacataccaa A - T G - C G - C C - G A - T C - G A - T T A T T A A C C A T G A A + | | | | G T C T C G G T T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |