Sequence ID | >WENV170012561 |
Genome ID | ASRL01001856 |
Phylum/Class | [ASRL] bioreactor metagenome; day 67 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1033 |
End posion on genome | 1108 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
atttgaaagt |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCGTCAGCCTTCCAAGCTGAATGTCGCCAGTTCGAAC |
Downstream region at tRNA end position |
taagcgccac |
Secondary structure (Cloverleaf model) | >WENV170012561 Gly TCC t TCCA taagcgccac G - C C - G G - C G - C G - C A - T A - T C A T T G G T C A T G A A + | | | | G T C T C G G C C A G C G | | | | T T G G A G C T A G ATGTC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |