Sequence ID | >WENV170012562 |
Genome ID | ASRL01001856 |
Phylum/Class | [ASRL] bioreactor metagenome; day 67 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1112 |
End posion on genome | 1187 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cgctccataa |
tRNA gene sequence |
GCGCCACTAGCTCAGTTGGTAGAGCACTCGACTTTTAATCGAGTTGTCACAGGTTCAACC |
Downstream region at tRNA end position |
taaaattagt |
Secondary structure (Cloverleaf model) | >WENV170012562 Lys TTT a ACCA taaaattagt G - C C - G G - C C - G C - G A - T C - G C C T T G T C C A T G A A | | | | | A T C T C G A C A G G C G | | | | T T G G A G C T A A TTGTC C - G T - A C - G G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |