Sequence ID | >WENV170012565 |
Genome ID | ASRL01001856 |
Phylum/Class | [ASRL] bioreactor metagenome; day 67 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1415 |
End posion on genome | 1502 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aaatgattat |
tRNA gene sequence |
GCCTGGGTGGCGGAATCGGTAGACGCACGGGACTTAAAATCCCGTGTCCTCTGTGGACGT |
Downstream region at tRNA end position |
ttnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170012565 Leu TAA t ACCA ttnnnnnnnn G - C C - G C - G T - A G + T G - C G - C T G T C G C C C A T A A G | | | | | A C G G C G G C G G G C G | | | T T G A C G C T A G A TGTCCTCTGTGGACGT C - G G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |