Sequence ID | >WENV170012579 |
Genome ID | ASRM01000004 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 55718 |
End posion on genome | 55794 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
tatcataaac |
tRNA gene sequence |
GCGTCTGTGGCTCAACTGGATAGAGCTCCCGGTTTCGGCCCGGGTGGTTGTGGGTTCGAA |
Downstream region at tRNA end position |
ttttataatt |
Secondary structure (Cloverleaf model) | >WENV170012579 Arg TCG c GCCA ttttataatt G + T C - G G - C T + G C - G T - A G - C T A T C A T C C A C A A G | | + | | G T C T C G G T G G G C G | | | | T T G G A G C A T A T TGGTT C - G C - G C - G G - C G - C T C T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |