Sequence ID | >WENV170012580 |
Genome ID | ASRM01000005 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 45638 |
End posion on genome | 45722 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aatgtatcaa |
tRNA gene sequence |
GCCTGTGTGGTGAAACTGGTAAACACGTCGGATTCAAAATCCGATGACTTAGGTCTTGAG |
Downstream region at tRNA end position |
tcttatctta |
Secondary structure (Cloverleaf model) | >WENV170012580 Leu CAA a ACCA tcttatctta G + T C - G C - G T - A G - C T - A G - C T G T C T C C C A C A A G | | | | | G T A G T G G A G G G C G | | | T T G A C A C T A A G TGACTTAGGTCTT T - A C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |