Sequence ID | >WENV170012581 |
Genome ID | ASRM01000025 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1842 |
End posion on genome | 1767 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tccctccatt |
tRNA gene sequence |
GGCCCCTTAGCTCAGTGGTTAGAGCAGTCGACTCATAATCGATTGGTCCGCAGTTCAAGT |
Downstream region at tRNA end position |
gatacagaaa |
Secondary structure (Cloverleaf model) | >WENV170012581 Met CAT t ACCA gatacagaaa G - C G - C C - G C - G C - G C - G T - A T G T G C G T C A T G A A | | | | | A G C T C G C G C A G C G | | | | T T T G A G C T A A TGGTC G + T T - A C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |