Sequence ID | >WENV170012587 |
Genome ID | ASRM01000075 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1199 |
End posion on genome | 1274 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccactttttt |
tRNA gene sequence |
GGAGGTATAGCAAAGTTGGTAATGCCCGGGATTGCAAATCCTGTATGCGTCGGTTCGAGT |
Downstream region at tRNA end position |
ctaatttcaa |
Secondary structure (Cloverleaf model) | >WENV170012587 Cys GCA t TCCA ctaatttcaa G - C G - C A - T G - C G - C T - A A - T T G T C G G C C A T G A A | + | | | G T A A C G G T C G G C G | | | T T G A T G C T A C TATGC C - G G + T G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |