Sequence ID | >WENV170012589 |
Genome ID | ASRM01000130 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 11338 |
End posion on genome | 11413 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ttagaccaat |
tRNA gene sequence |
TCCCCCTTAGTTCAGTTGGTAGAACGGCGGACTGTTAATCCGTATGTCGCAAGTTCAAGT |
Downstream region at tRNA end position |
aattccagaa |
Secondary structure (Cloverleaf model) | >WENV170012589 Asn GTT t GCCA aattccagaa T - A C - G C - G C - G C - G C - G T - A T G T C G T T C A T G A A | | | | | A T C T T G G C A A G C G | | | | T T G G A A C T A G ATGTC G + T C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |