Sequence ID | >WENV170012590 |
Genome ID | ASRM01000271 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1014 |
End posion on genome | 938 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cccctaagtt |
tRNA gene sequence |
GCTCCGTTAGCTCAGCTGGATAGAGCACCCGCCTTCTAAGCGGGTGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
tattagataa |
Secondary structure (Cloverleaf model) | >WENV170012590 Arg TCT t GCCA tattagataa G - C C - G T - A C - G C - G G - C T - A T A T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A TGGTC C - G C - G C - G G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |