Sequence ID | >WENV170012591 |
Genome ID | ASRM01000343 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 162 |
End posion on genome | 86 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gatagggcat |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCGTTGGCCTCCGGAGCCAAAGGTCGAAGGTTCGAA |
Downstream region at tRNA end position |
ttcggaggtg |
Secondary structure (Cloverleaf model) | >WENV170012591 Arg CCG t GCCA ttcggaggtg G - C C - G G - C C - G C - G C - G G - C T A T T T T C C A C G A A + | | | | G T C T C G G A A G G C G | | | | T T G G A G C A T A G AGGTC T - A T - A G - C G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |