Sequence ID | >WENV170012592 |
Genome ID | ASRM01000344 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 7142 |
End posion on genome | 7055 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GGAGAGATGGCTGAGTGGCCGAAAGCACCTGACTTGAAATCAGGCGACGGGCGACCGTCC |
Downstream region at tRNA end position |
cattagaaaa |
Secondary structure (Cloverleaf model) | >WENV170012592 Ser TGA n GCCA cattagaaaa G - C G - C A - T G - C A - T G - C A - T T A T A T C T C A T G A G | | | | | G G G T C G T A G A G C G | | | T T C A A G C C G A A CGACGGGCGACCGTCC C - G C - G T - A G - C A - T C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |