Sequence ID | >WENV170012595 |
Genome ID | ASRM01000761 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 2963 |
End posion on genome | 2887 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tatgcttttc |
tRNA gene sequence |
GCTGATATAGCTCAGCCCGGTAGAGCGCACCCTTGGTAAGGGTGAGGTCCCCAGTTCGAG |
Downstream region at tRNA end position |
gtttttactt |
Secondary structure (Cloverleaf model) | >WENV170012595 Thr GGT c ACCA gtttttactt G - C C - G T - A G - C A - T T - A A - T T G T G G G T C A C G A A | | | | | G C C T C G C C C A G C C | | | | T T G G A G C G T A G AGGTC C - G A - T C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |