Sequence ID | >WENV170012596 |
Genome ID | ASRM01000818 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1806 |
End posion on genome | 1731 |
Amino Acid | Asp |
Anticodon | ATC |
Upstream region at tRNA start position |
aatgtagcat |
tRNA gene sequence |
GCGACACTAGTTCAGTTGGTAGAGCGCAACCTTATCGAGGTTGAGGTCATCGGTTCGAAC |
Downstream region at tRNA end position |
aatttcttta |
Secondary structure (Cloverleaf model) | >WENV170012596 Asp ATC t TCCA aatttcttta G - C C T G - C A - T C - G A - T C - G C A T A A G C C A T G A A | | | | G T C T T G A T C G G C G | | + | T T G G A G C T A G AGGTC C - G A - T A - T C - G C - G T A T G A T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |