Sequence ID | >WENV170012598 |
Genome ID | ASRM01000957 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 838 |
End posion on genome | 762 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tgaaaccaac |
tRNA gene sequence |
GTCCCCTTGGCACAGCTGGATAGCGCGACTCCCTCCTAAGGAGTAGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
tttttcgttg |
Secondary structure (Cloverleaf model) | >WENV170012598 Arg CCT c GCCA tttttcgttg G - C T - A C - G C - G C - G C - G T - A T A T T G T C C A C G A G | | | | | G T C A C G A C A G G C G | | | T T G G C G C A T A G AGGTC A - T C - G T - A C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |