Sequence ID | >WENV170012600 |
Genome ID | ASRM01001118 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 126 |
End posion on genome | 51 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cctgtaatgt |
tRNA gene sequence |
TCCGCGATAGCTCAGTTGGTAGAGCAAATGACTGTTAATCATTGGGTCCCTGGTTCGAGT |
Downstream region at tRNA end position |
tcggggtata |
Secondary structure (Cloverleaf model) | >WENV170012600 Asn GTT t GCCA tcggggtata T - A C - G C - G G + T C - G G - C A - T T G T G G A C C A T G A A | | | | | G T C T C G C C T G G C G | | | | T T G G A G C T A A GGGTC A - T A - T T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |