Sequence ID | >WENV170012605 |
Genome ID | ASRM01001514 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 236 |
End posion on genome | 146 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cccgtgttac |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGCCGAAGGCGCTCCCCTGCTAAGGGAGTACACCTCAAAAGGGT |
Downstream region at tRNA end position |
tatttagtgt |
Secondary structure (Cloverleaf model) | >WENV170012605 Ser GCT c GCCA tatttagtgt G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C C G A G TACACCTCAAAAGGGTGTC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |