Sequence ID | >WENV170012609 |
Genome ID | ASRM01001946 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 32 |
End posion on genome | 107 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tgggcattaT |
tRNA gene sequence |
GGGGCACTAGCTCAGTCGGCTAGAGCACTAGACTTTTAATCTAGGTGTCCCGGGTTCGAG |
Downstream region at tRNA end position |
aaaacacatt |
Secondary structure (Cloverleaf model) | >WENV170012609 Lys TTT T ATtc aaaacacatt G - C G + T G - C G - C C - G A - T C - G T G T G G C C C A T G A A | | | | | G C C T C G C C G G G C G | | | | T T G G A G C C T A A GTGTC C - G T - A A - T G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |