Sequence ID | >WENV170012615 |
Genome ID | ASRM01003024 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 959 |
End posion on genome | 883 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
tacttatgtt |
tRNA gene sequence |
GCATCTATAGCTCAATTGGATAGAGCGTCTGACTTCGGATCAGAAGGTTATGGGTTCGAT |
Downstream region at tRNA end position |
tttatattaa |
Secondary structure (Cloverleaf model) | >WENV170012615 Arg TCG t GCCA tttatattaa G - C C - G A - T T + G C - G T - A A - T T T T T A T C C A T A A A | | + | | G T C T C G A T G G G C G | | | | T T G G A G C A T A G AGGTT T - A C - G T - A G - C A - T C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |