Sequence ID | >WENV170012616 |
Genome ID | ASRM01003534 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 668 |
End posion on genome | 584 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cgttccttct |
tRNA gene sequence |
GCCCAGATGGTGGAATTGGTAGACACGCGAGACTTAAAATCTCGTTTCTTCGGAAGTGCG |
Downstream region at tRNA end position |
ttccaaaata |
Secondary structure (Cloverleaf model) | >WENV170012616 Leu TAA t ACCA ttccaaaata G - C C - G C - G C - G A - T G - C A - T T T T C G C C C A T A A G | | | | | G T G G T G G C G G G C G | | | T T G A C A C T A G G TTTCTTCGGAAGT C - G G - C A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |