Sequence ID | >WENV170012617 |
Genome ID | ASRM01003603 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 705 |
End posion on genome | 779 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
agacatacaa |
tRNA gene sequence |
GCCGGGTTAGCTCAGGGGTAGAGCAGGGGATTGAAAATCCCTGTGTCGCAAGTTCAAATC |
Downstream region at tRNA end position |
ttgaaagaaa |
Secondary structure (Cloverleaf model) | >WENV170012617 Phe GAA a ACCA ttgaaagaaa G - C C - G C - G G - C G + T G - C T - A T A T C G C T C A G A A | | | | A G C T C G G C A A G C G | | | | T T G G A G C T A A GTGTC G + T G - C G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |