Sequence ID | >WENV170012624 |
Genome ID | ASRM01004914 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 104 |
End posion on genome | 188 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
attatacaat |
tRNA gene sequence |
GGGCAGATTCCAGAGTGGCCAAATGGGGCGGACTGTAAATCCGCTAGCTTAGCTTTCGGG |
Downstream region at tRNA end position |
ttgttttaat |
Secondary structure (Cloverleaf model) | >WENV170012624 Tyr GTA t ACCA ttgttttaat G - C G - C G - C C - G A - T G - C A - T T A T C T C C C A T G A T | + | | | G G G A C C G G G G G C G | | | T T C A T G G C A A G TAGCTTAGCTTTC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |