Sequence ID | >WENV170012627 |
Genome ID | ASRM01005511 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 619 |
End posion on genome | 544 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tagatattac |
tRNA gene sequence |
GGGTTATTAGCTCAGTTGGTAGAGCAGCTCCCTTTTAAGGAGAAGGTCCTGGGTTCGAGC |
Downstream region at tRNA end position |
tttttgaaaa |
Secondary structure (Cloverleaf model) | >WENV170012627 Lys TTT c ACCA tttttgaaaa G - C G - C G - C T - A T + G A - T T - A C G T G G C C C A T G A A | + | | | G T C T C G C T G G G C G | | | | T T G G A G C T A A AGGTC G A C - G T - A C - G C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |