Sequence ID | >WENV170012630 |
Genome ID | ASRM01005704 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 596 |
End posion on genome | 520 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aaaatactac |
tRNA gene sequence |
AGGGGTGTAGCTCCAATTGGCAGAGCAGCGGATTCCAAATCCGCGTGTTGGGAGTTCGAA |
Downstream region at tRNA end position |
tacaaattgc |
Secondary structure (Cloverleaf model) | >WENV170012630 Trp CCA c GCCA tacaaattgc A - T G - C G - C G - C G - C T - A G - C T A T C T C T C A A A C A | + | | | G T C T C G G G G A G C T | | | | T T G G A G C G C A A GTGTT G - C C - G G - C G - C A - T T A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |