Sequence ID | >WENV170012634 |
Genome ID | ASRM01008055 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 458 |
End posion on genome | 382 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cataaatatg |
tRNA gene sequence |
GTGCCCTTAGTTCAGTTGGTTAGAACGCCAGGTTGTGATTCTGGAGGTCGTGGGTTCGAT |
Downstream region at tRNA end position |
tattaaaatt |
Secondary structure (Cloverleaf model) | >WENV170012634 His GTG g CCCA tattaaaatt G - C T - A G - C C - G C - G C - G T - A C T T T A C C C A T G A A + | | | | G T C T T G G T G G G C G | | | | T T G G A A C T T A G AGGTC C - G C - G A - T G - C G + T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |