| Sequence ID | >WENV170012636 |
| Genome ID | ASRM01008848 |
| Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
| Species | |
| Start position on genome | 170 |
| End posion on genome | 94 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
ataggtgaga |
| tRNA gene sequence |
GGGCCTATAGCTCAGCTGGCTAGAGCGCTCGACTGATAATCGTGAGGTCCCAGGTTCAAG |
| Downstream region at tRNA end position |
tgattaaata |
| Secondary structure (Cloverleaf model) | >WENV170012636 Ile GAT
a ACCA tgattaaata
G - C
G - C
G - C
C - G
C - G
T - A
A - T T G
T G G T C C A
C G A A | | | | | A
T C T C G C C A G G C
G | | | | T T
G G A G C
C T A G AGGTC
C - G
T T
C - G
G - C
A - T
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |