Sequence ID | >WENV170012637 |
Genome ID | ASRM01009216 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 344 |
End posion on genome | 420 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ataaacaaat |
tRNA gene sequence |
GCGGGCATAGCTCAATTGGCTAGAGCATCTGCCTTCCAAGCAGAGGGTTGTGAGTTCGAG |
Downstream region at tRNA end position |
attcaaactt |
Secondary structure (Cloverleaf model) | >WENV170012637 Gly TCC t TCCA attcaaactt G - C C - G G - C G - C G - C C - G A - T T G T T A C T C A T A A A + | | | | G T C T C G G T G A G C G | | | | T T G G A G C C T A A GGGTT T - A C - G T - A G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |