Sequence ID | >WENV170012638 |
Genome ID | ASRM01010648 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 40 |
End posion on genome | 116 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ttttttatcc |
tRNA gene sequence |
GGGTGTATAGCTCAGTTGGTTAGAGCGCACGACTGATAATCGTGAGGTCCCTGGTTCAAC |
Downstream region at tRNA end position |
tgataaaaat |
Secondary structure (Cloverleaf model) | >WENV170012638 Ile GAT c ACCA tgataaaaat G - C G - C G - C T - A G + T T - A A - T T C T G G A C C A T G A A | | | | | A T C T C G C C T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |