Sequence ID | >WENV170012643 |
Genome ID | ASRM01015191 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 53 |
End posion on genome | 129 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tctatatgat |
tRNA gene sequence |
GACTCTGTAGCTCAGATGGATAGAGCGGCTCCCTCCTAAGGAGTAGGCCATGCGTTCGAA |
Downstream region at tRNA end position |
tcttttaaaa |
Secondary structure (Cloverleaf model) | >WENV170012643 Arg CCT t ACCA tcttttaaaa G - C A - T C - G T + G C - G T - A G - C T A T T G C G C A A G A A | + | | | G T C T C G A T G C G C G | | | | T T G G A G C A T A G AGGCC G + T C - G T - A C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |