Sequence ID | >WENV170012646 |
Genome ID | ASRM01015706 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 133 |
End posion on genome | 57 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ttattatttt |
tRNA gene sequence |
GCTGGTGTAGCTCAGTTGGCTAGAGCAGCTGATTTGTAATCAGCAGGTCGTAGGTTCGAC |
Downstream region at tRNA end position |
cttatattgg |
Secondary structure (Cloverleaf model) | >WENV170012646 Thr TGT t TCCA cttatattgg G - C C - G T - A G - C G - C T - A G - C T C T T A T C C A T G A A + | | | | G T C T C G G T A G G C G | | | | T T G G A G C C T A A AGGTC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |