Sequence ID | >WENV170012649 |
Genome ID | ASRM01019543 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 64 |
End posion on genome | 140 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
aagctaaaaa |
tRNA gene sequence |
GGGTGATTAGCTCAGTTGGCGAGAGCATCTGCCTTACAAGCAGGGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
tttgaaaaat |
Secondary structure (Cloverleaf model) | >WENV170012649 Val TAC a ACCA tttgaaaaat G - C G - C G - C T - A G - C A - T T - A T A T C T C C C A T G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C C G A A GGGTC T + G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |