Sequence ID | >WENV170012668 |
Genome ID | ASRN01000150 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 12689 |
End posion on genome | 12614 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
actttaattT |
tRNA gene sequence |
GTTCTTGTAGCTCAGTAGGATAGAGCGACCGCCTCCTAAGCGGTAGGCCGTGGGTTCGAA |
Downstream region at tRNA end position |
gaaaagtact |
Secondary structure (Cloverleaf model) | >WENV170012668 Arg CCT T GTta gaaaagtact G - C T - A T - A C - G T - A T - A G - C T A T C G C C C A T G A A | + | | | G A C T C G G T G G G C G | | | | T T G G A G C A T A G AGGCC A - T C - G C - G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |