Sequence ID | >WENV170012674 |
Genome ID | ASRN01000244 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 8701 |
End posion on genome | 8627 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
agatgtagat |
tRNA gene sequence |
TCCGGCATAGCTCAGCGGTAGAGTAGGTGACTGTTAATCACTTGGTCCCAGGTTCGAATC |
Downstream region at tRNA end position |
cattcatttt |
Secondary structure (Cloverleaf model) | >WENV170012674 Asn GTT t GCCA cattcatttt T - A C - G C - G G - C G - C C - G A - T T A T G G T C C A G A A | | | | | G C C T C G C C A G G C G | | | + T T G G A G T T A A TGGTC G + T G - C T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |