Sequence ID | >WENV170012675 |
Genome ID | ASRN01000278 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 3952 |
End posion on genome | 3877 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
taggcagtaa |
tRNA gene sequence |
GCTCTTATGGCACAGGAGGTAGCGCGCATCCATGGTAAGGATGAGGTCACCGGTTCGAAT |
Downstream region at tRNA end position |
ggaatctcga |
Secondary structure (Cloverleaf model) | >WENV170012675 Thr GGT a TCAA ggaatctcga G - C C - G T - A C - G T - A T - A A - T T A T T G G C C A G G A G | | | | | G A C A C G A C C G G C G | | | T T G G C G C T A G AGGTC C - G A - T T - A C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |