Sequence ID | >WENV170012682 |
Genome ID | ASRN01000740 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 926 |
End posion on genome | 842 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ctttttttgt |
tRNA gene sequence |
GCCTGTATGGTGAAATTGGTATACACGCTAGATTCAAAATCTGGTTCCTTCGGGAGTGTC |
Downstream region at tRNA end position |
ccgaacacaa |
Secondary structure (Cloverleaf model) | >WENV170012682 Leu CAA t ACCA ccgaacacaa G + T C - G C - G T - A G - C T - A A - T T C T C A G C C A T A A G | | | | | G T A G T G G T C G G C G | | | T T G A C A C T A T G TTCCTTCGGGAGT C - G T + G A - T G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |