Sequence ID | >WENV170012689 |
Genome ID | ASRN01001557 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 2292 |
End posion on genome | 2220 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tcaagtccca |
tRNA gene sequence |
GGGCGCATAGCTCAGCTGGGAGAGCACCTGCCTTACAAGCAGGGGGTCACAGGTTCGAGC |
Downstream region at tRNA end position |
gagattatat |
Secondary structure (Cloverleaf model) | >WENV170012689 Val TAC a Atta gagattatat G - C G - C G - C C - G G - C C - G A - T C G T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |