Sequence ID | >WENV170012691 |
Genome ID | ASRN01001657 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 262 |
End posion on genome | 337 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ggccgccatt |
tRNA gene sequence |
GCCGGTATAGCTCAGTTGGTAGAGCAACTGACTTGTAATCAGTAGGTCCCGAGTTCGACT |
Downstream region at tRNA end position |
cattaaagtc |
Secondary structure (Cloverleaf model) | >WENV170012691 Thr TGT t ACCA cattaaagtc G - C C - G C - G G - C G - C T + G A - T T C T G G T T C A T G A A | | + | | G T C T C G C C G A G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |