Sequence ID | >WENV170012692 |
Genome ID | ASRN01001757 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 21 |
End posion on genome | 95 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gcctacaagt |
tRNA gene sequence |
GATCGCGTAACTCAGTGGTAGAGTGCCACCTTGACATGGTGGTGGTCGGTGGTTCAAGTC |
Downstream region at tRNA end position |
ttacttcttt |
Secondary structure (Cloverleaf model) | >WENV170012692 Val GAC t ACCA ttacttcttt G - C A - T T - A C - G G + T C - G G - C T G T T C A C C A G A A + | | | | A T C T C A G G T G G C G | | | | T T G G A G T T A G TGGTC C - G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |