Sequence ID | >WENV170012695 |
Genome ID | ASRN01001888 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1127 |
End posion on genome | 1203 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
aaaacatcgt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCCGGTAGCGCACTTGCATGGGGTGCAAGGGGTCGAGTGTTCGAA |
Downstream region at tRNA end position |
tataaaacaa |
Secondary structure (Cloverleaf model) | >WENV170012695 Pro GGG t ACCA tataaaacaa C - G G - C G - C G - C G + T C - G G - C T A T C T C A C A C G A A | | | | | G C C G C G G A G T G C C | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |