Sequence ID | >WENV170012697 |
Genome ID | ASRN01002081 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1357 |
End posion on genome | 1282 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
caaaatatat |
tRNA gene sequence |
GCACGAGTAGCTCAGTTGGAAGAGCAGCGCCCTTCTAAGGCGAAGGTCACAGGTTCGAGC |
Downstream region at tRNA end position |
tttaagtcca |
Secondary structure (Cloverleaf model) | >WENV170012697 Arg TCT t ACCA tttaagtcca G + T C - G A - T C - G G - C A - T G - C C G T T G T C C A T G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A A A AGGTC G A C - G G - C C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |