Sequence ID | >WENV170012704 |
Genome ID | ASRN01002608 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 175 |
End posion on genome | 251 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gcaccgaaat |
tRNA gene sequence |
GGACTCATAGCTCAGCTGGATAGAGTACTCGGCTACGAACCGAGCGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
tattaaaaaa |
Secondary structure (Cloverleaf model) | >WENV170012704 Arg ACG t GCCA tattaaaaaa G - C G - C A - T C - G T - A C - G A - T T A T C C T C C A C G A A | | | | | G T C T C G G G A G G C G | | | + T T G G A G T A T A A CGGTC C - G T - A C - G G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |