Sequence ID | >WENV170012707 |
Genome ID | ASRN01003097 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 142 |
End posion on genome | 65 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
cgatgaaaat |
tRNA gene sequence |
CGGGGTGTGGCTCAGCTTGGCTAGAGCGCTTGATTTGGGTTCAAGAGGCCGCAGGTTCGA |
Downstream region at tRNA end position |
catatgcggg |
Secondary structure (Cloverleaf model) | >WENV170012707 Pro TGG t ACTA catatgcggg C - G G - C G - C G - C G - C T - A G - C T A T T G T C C A T C G A G + | | | | G T C T C G G C A G G C G | | | | T T G G A G C C T A G AGGCC C - G T - A T - A G - C A - T T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |