Sequence ID | >WENV170012714 |
Genome ID | ASRN01003838 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 702 |
End posion on genome | 775 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tatcatgtgc |
tRNA gene sequence |
CGGGATATAGCTCAGTTTGGTAGAGCGCATGCTTCGGGAGTATGAGGCCGCAGGTTCGAA |
Downstream region at tRNA end position |
atacatgtaa |
Secondary structure (Cloverleaf model) | >WENV170012714 Pro CGG c Atgg atacatgtaa C - G G - C G - C G - C A - T T - A A - T T A T T G T C C A T G A A + | | | | G T C T C G G C A G G C T | | | | T T G G A G C G T A G AGGCC C - G A - T T - A G + T C - G T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |