Sequence ID | >WENV170012718 |
Genome ID | ASRN01004522 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 233 |
End posion on genome | 149 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cctcgcttaa |
tRNA gene sequence |
GGAGGGGTTCCCGAGCGGCCAAAGGGATCAGACTGTAAATCTGACGTCTACGACTTCGAA |
Downstream region at tRNA end position |
tatttcaagc |
Secondary structure (Cloverleaf model) | >WENV170012718 Tyr GTA a ACCA tatttcaagc G - C G - C A - T G - C G - C G - C G + T T A T C T T C C A C G A T | | | | | G G G C C C G A A G G C G | | | T T C A G G G C A A A CGTCTACGACTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |