Sequence ID | >WENV170012721 |
Genome ID | ASRN01004658 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 4 |
End posion on genome | 78 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
nnnnnnnagt |
tRNA gene sequence |
GGTCCCTTCATCTAATGGTTAGGATTCAAGGTTTTCATCCTTGCCATAGGGGTTCGAATC |
Downstream region at tRNA end position |
ataatttgct |
Secondary structure (Cloverleaf model) | >WENV170012721 Glu TTC t ACCA ataatttgct G - C G + T T - A C - G C - G C - G T - A T A T T C C C C A T A A C | | | | | G G T C T A A G G G G C G + | | | T T T G G A T T A T CCAT C - G A - T A - T G - C G - C T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |