Sequence ID | >WENV170012741 |
Genome ID | ASRO01000003 |
Phylum/Class | [ASRO] bioreactor metagenome; day 119 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 31434 |
End posion on genome | 31358 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tcatattgtg |
tRNA gene sequence |
GTAGGTATAGCTCAGTTGGTTAGAGCATCGGGTTGTGGTTCCGAGGGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
ttttttattg |
Secondary structure (Cloverleaf model) | >WENV170012741 His GTG g CCCA ttttttattg G - C T - A A - T G - C G + T T - A A - T C G T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G G - C G - C G + T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |