Sequence ID | >WENV170012742 |
Genome ID | ASRO01000003 |
Phylum/Class | [ASRO] bioreactor metagenome; day 119 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 31348 |
End posion on genome | 31272 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
attttttatt |
tRNA gene sequence |
GCGTCCTTAGCTCAGCTGGATAGAGCAACGCCCTTCTAAGGCGTAGGCCAAAGGTTCGAA |
Downstream region at tRNA end position |
ttttttgaag |
Secondary structure (Cloverleaf model) | >WENV170012742 Arg TCT t ACCA ttttttgaag G + T C - G G - C T + G C - G C - G T - A T A T T T T C C A C G A A | | | | | G T C T C G A A A G G C G | | | | T T G G A G C A T A A AGGCC A - T C - G G - C C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |